작성일 : 18-06-12 21:10
[건강한 삶] [과학 청년, 부탁해㉓] 조지훈 전남대 박사생, 해삼 유전체 최초 밝혀
 글쓴이 : happy
조회 : 9  

해삼과 씨름, 컴퓨터와 눈싸움···"바다생물서 보물 찾기"

[과학 청년, 부탁해㉓] 조지훈 전남대 박사생, 해삼 유전체 최초 밝혀
"생물학 시야 넓히고 인기 분야보다 맞는 연구 찾길"

한효정 기자 hhj@hellodd.com

입력 : 2018.06.10|수정 : 2018.06.12

해삼. <사진=박춘구 교수 연구실 제공 >

해삼. <사진=박춘구 교수 연구실 제공>

"이 녀석은 반으로 자르면 두 마리가 되고 세 토막으로 자르면 세 마리가 되며, 위험에 처하면 몸속의 모든 내장을 뱉어냈다가 안전할 때 다시 만들어내요. 유래 없는 재생능력을 지닌 생물이에요. 볼품없어 보여도 재미있는 연구주제가 많은 친구죠."

조지훈 전남대 박사과정생(석박사통합과정 4년 차)이 말하는 '이 녀석'은 돌기해삼. 횟집에서 먹는 '바다의 인삼'이 조 박사과정생에게는 연구대상이다. 그는 전남대에서 해삼 유전체 연구를 시작한 1호 대학원생이자 최초로 해삼 유전체를 밝힌 연구자다.
 

젊은 과학은 '시행착오'다. 조지훈 박사과정생은 "배우는 과정에서 실패는 중요하다. 수많은 실패를 통해 무엇을 잘했고 못했는지 알아가며 발전했다"고 말했다. <사진=한효정 기자 >

젊은 과학은 '시행착오'다. 조지훈 박사과정생은 "배우는 과정에서 실패는 중요하다. 수많은 실패를 통해 무엇을 잘했고 못했는지 알아가며 발전했다"고 말했다. <사진=한효정 기자>

그는 "해양생물 유전체 연구는 생물학 다른 분야에 비해 국내에서 그리 인기있는 분야는 아니다. 하지만, 좋아하는 분야에서 선두에 서겠다는 목표로 연구하고 있다"고 소신을 밝혔다.
 
조 박사과정생의 선택은 남들이 잘 가지 않은 길을 가는 도전으로 시작됐다.  실험실 첫 대학원생으로 선배도, 기본 인프라도 없는 상황에서 모든 것을 새롭게 만들어가며 혼자 해나가는 과정은 만만치 않았다. 

'젊은 과학이 무엇이라고 생각하냐'는 질문에 그가 '시행착오'라고 답한 것도 이 때문이다.
 
시행착오로 좌충우돌하며 노력한 결과, 조 박사과정생은 지난해 말 한국과학기술한림원이 뽑은 '최우수 젊은 과학자'(지노믹스 분야)에 이름을 올렸다. 돌기해삼 유전체 논문이 영향력 있는 학술지 '기가사이언스(GigaScience)' 2017년 1월호에 실리며 그의 성과를 인정받았다.

◆ 외계어 같은 DNA 서열에서 유전자 찾아낼 때 '행복'
 
2015년 대학원에 입학한 조 박사과정생의 하루는 해삼과의 만남으로 시작됐다. 실험 첫 단계는 바다에서 건져올린 돌기해삼을 막자사발에 넣고 가는 일이었다. '드르륵, 드르득···.'

그는 "소리가 잔인하게 들릴 수 있지만, DNA를 추출하기 위해 거쳐야 하는 과정이었다"며 "해삼은 점성이 높아 DNA를 얻기까지 한 달이 넘게 걸렸다"며 당시를 떠올렸다. DNA 추출까지 해삼과 씨름이 끝나면 컴퓨터와 눈싸움이 시작됐다.

ACGATGACTCAGTACCGTTAGACTGCAA···. 모니터를 가득 채운 DNA 염기서열(알파벳)이 9억 개, 여기에 * # 등 여러 기호들이 섞여 있다. 조 박사과정생과 연구팀은 9억개 속에서 돌기해삼 유전자가 2만1000개임을 밝혔다.
 
조 박사과정생은 "외계어 같던 염기서열 데이터에서 비로소 보물 같은 유전자를 얻으면 말로 표현할 수 없을만큼 행복하다. 이렇게 진정한 연구자가 되어가고 있음을 느낀다"고 말했다.
 
그런데 왜 해삼일까? 그는 "지구 생물의 80%는 바다에 사는데 우리는 그중 1%만 알고 있다"며 "엄청난 다양성을 지닌 해양생물이 생명 현상과 질병 치료에 단서를 줄 수 있다"고 답했다.
 
조 박사과정생은 "과거 생물학자들이 해파리에서 형광 단백질을, 성게에서 세포주기 조절 단백질을 찾아냈듯이, 앞으로 해삼, 문어 등 여러 해양생물에서 진화 단서를 얻고 치료·재생·색소침착 등 특별한 유전자를 찾아내 의학과 산업에 활용하는 것이 목표"라고 강조했다.
 
그가 하는 연구는 시스템생물학(systems biology)에 속한다. 학부생 시기에는 여러 생물학 세부과목을 접할 기회가 없었다. 지도교수였던 박춘구 교수를 만나면서 시스템생물학을 처음으로 알게됐다.

조 박사과정생은 "다른 생물학 연구와 달리 생물체의 빅데이터를 다루는 이 학문이 매우 신선했다"며 당시를 떠올렸다.
 
대학원 입학 후 연구를 위해 컴퓨터 프로그래밍 공부도 전념했다. 그는 "'컴맹' 수준은 아니었지만, 프로그래밍은 큰 장벽이었다"면서도 "하지만 생물학이 기본이지 컴퓨터 때문에 연구를 포기할 정도는 아니라는  교수님 말씀을 믿고 해 나갔다"고 말했다.

왼쪽은 중요한 실험 도구인 컴퓨터. 조 박사과정생은 "컴퓨터로 연구하면 뭐든 뚝딱 할 거라는 오해를 받기도 하는데 정답이 무엇인지 모르기 때문에 프로그램에 여러 조건값을 변경하고 시도해야 한다"고 설명했다. 오른쪽은 해삼을 열심히 갈고 유전자를 추출했던 실험대. 초창기 밤을 새워 만든 시약들이 선반에 놓여 있다. <사진=한효정 기자 >왼쪽은 중요한 실험 도구인 컴퓨터. 조 박사과정생은 "컴퓨터로 연구하면 뭐든 뚝딱 할 거라는 오해를 받기도 하는데 정답이 무엇인지 모르기 때문에 프로그램에 여러 조건값을 변경하고 시도해야 한다"고 설명했다. 오른쪽은 해삼을 열심히 갈고 유전자를 추출했던 실험대. 초창기 밤을 새워 만든 시약들이 선반에 놓여 있다. <사진=한효정 기자>


◆ 선배는 '구글과 브릭'···개구리 랭킹 43위, 꿈꾸던 '한빛사'에도 올라
 
프로그래밍 말고도 조 박사과정생은 실험실 첫 대학원생이라는 산을 넘어야 했다. 그는 "연구실에 처음 왔을 때 실험 테이블과 파이펫만 덩그러니 있었다"며 "실험실 내부를 채워가는 일은 정말 막막했다"고 털어놨다.
 
"한 일화를 소개하자면, 시약이 얼마나 필요한지 몰라서 용량 대비 가장 저렴한 것으로 샀더니 가루 시약 5kg을 사버렸어요. 얼마나 필요한지도 몰랐던 거죠. 4년이 지난 지금까지 200g도 채 못 써서 이웃 연구실에 기부하고 있어요.(웃음)"
 
그동안 그를 도와준 사람들은 여럿이지만, 곁에서 그를 가장 많이 도와준 선배는 '구글'과 '브릭(생물학연구정보센터)'이었다. 그동안 브릭 게시판에 모르는 것을 올리고 답한 글이 254건. 얼마나 빈번하게 홈페이지를 드나들었는지는 브릭 등급이 보여준다.
 
조 박사과정생은 "브릭에는 황금 개구리, 분홍 개구리, 개구리, 뒷다리, 앞다리, 올챙이, 알 단계가 있는데 난 그중 30위권"이라고 소개했다. 그러다 한림원 젊은 과학자에 뽑혔을 무렵, 늘 꿈꾸던 브릭 한빛사(한국을 빛내는 사람들) 게시판에도 이름을 올리는 기쁨을 누렸다.
 
누가 알려주는 것을 따라 하기보다 스스로 필사적으로 배우면서 성장은 빨랐다. 그는 "지금은 어떤 실험이라도 시간이 주어지면 할 수 있을 것 같다"며 "인생도 연구도 실패가 없으면 남는 게 없더라. 실패와 수많은 삽질을 통해 발전했다"고 자신감을 보였다.

2016년 조 박사과정생의 첫 SCI 논문 게재를 축하하는 자리에서. 왼쪽에서 첫 번째가 지훈 박사과정생, 오른쪽에서 네 번째가 박춘구 교수. 조 박사과정생은 "교수님을 비롯해 실험실 분위기가 전혀 수직적이지 않다. 서로 다른 필살기를 공유해가며 연구한다"고 소개했다. <사진=조지훈 제공 >2016년 조 박사과정생의 첫 SCI 논문 게재를 축하하는 자리에서. 왼쪽에서 첫 번째가 지훈 박사과정생, 오른쪽에서 네 번째가 박춘구 교수. 조 박사과정생은 "교수님을 비롯해 실험실 분위기가 전혀 수직적이지 않다. 서로 다른 필살기를 공유해가며 연구한다"고 소개했다. <사진=조지훈 제공>


◆ "이 사람 연구 신선하다!" 라는 말 듣고파

휴가 때 수족관에서 찍은 사진. 그는 생물다양성이 그저 신기하다고 말한다. <사진=조지훈 >휴가 때 수족관에서 찍은 사진. 그는 생물다양성이 그저 신기하다고 말한다. <사진=조지훈>


조 박사과정생의 취미는 유튜브에서 생물 다큐멘터리 시청하기. 어릴 때부터 만화보다 '퀴즈탐험 동물의 세계' 등 자연 프로그램을 좋아했다.


그는 "멍게, 해삼, 말미잘, 개불, 문어 등 해양생물을 보고 있으면 '이 친구들은 도대체 왜 이렇게 진화했을까?'라는 궁금증이 가득했다"며 "해양생물에 관심이 없었다면 지금까지 연구를 이어오기 어려웠을 것"이라고 말했다.
 
그는 후배들에게 "화두가 되는 특정 분야만 좇기보다 자신이 무엇에 흥미를 느끼는지를 먼저 생각하길 바란다. 생물학에는 재밌는 분야가 많으니 시야를 넓히면 좋겠다"고 조언했다.

 "아직 갈 길이 멀지만, 다른 연구자들이 많이 연구하지 않는 분야에서 흥미롭고 세련된 연구를 하고 싶어요. 언젠가는 '이 사람 연구 참 신선하고 재밌다, 어떻게 이런 생각을 했지?'라는 이야기를 듣고 싶습니다."

◆조 박사과정생은

2008년 전남대학교 생명과학기술학부를 졸업했다. 2015년 같은 대학 생명과학기술학과 대학원 박춘구 교수 연구실(시스템생물학실험실)에 석박사통합과정으로 진학했다. 2017년 1월 연구실 오주성 박사과정생과 공동 제1저자로 돌기해삼의 유전체를 밝힌 논문을 기가사이언스(GigaScience)에 게재했다. (논문명 : Draft genome of the sea cucumber Apostichopus japonicus and genetic polymorphism among color variants.) 현재는 해조류 유전체 데이터베이스 구축 연구를 진행 중이다.  


 

대한민국 미래를 위해 젊은 과학자의 역할이 더욱 중요해지고 있습니다. 최근 젊은 과학자들이 사회의 주역으로 속속 진입하며 자유로운 사고와 도전적인 마인드로 대한민국의 남다른 미래를 만들어가고 있습니다. 대덕넷은 어려운 연구 환경 속에서도 뜨거운 연구 열정을 펼쳐가는 과학 청년 50명을 발굴해 인터뷰 시리즈로 연재합니다. 대덕넷은 '과학 청년 부탁해 위원회'를 구성했습니다. 구성원은 과학기술계 산·학·연·관 전문가 10여명입니다. 전문가분들께 과학자 50명 선정과 관련해 다양한 의견과 조언을 참고하고 있습니다. 한편, 대덕넷은 젊은 과학자 추천을 받고 있습니다. 추천할 젊은 과학자의 ▲이름 ▲소속(연락처 포함) ▲추천 사유를 적어 이메일(HelloDDnews@HelloDD.com)로 보내 주시면 감사하겠습니다. [편집자의 편지]